Superlady Superlady

25-02-2015
Physics

contestada

what type of simple machine is a slide shovel broom screwdriver

Respuesta :

Аноним Аноним

25-02-2015

a wheely because you see when you push it it has the scwers stong

Answer Link

25-02-2015

Its a wheel and axle, the screwdriver is the wheel and your hand is the axle.

Answer Link

Otras preguntas

Read the sentence. The blue car is bigger than the red car. I decided to buy the red one. Which answer choice correctly uses a transition to connect the ideas i

How are Gustus and Mr.Bass similar and different

Manganese, Mn, forms two ions, one with a 2+ charge and one with a 3+ charge. What is the formula for manganese (II) sulfide?

What are three factors that control deep currents?

All these? Please helppp and I need work

Please I need help ASAP!Identify ONE way in which African states or societies changed as a result of the spread of Islam in the period circa 1200 to 1450.

Determine the pressure change when a constant volume of gas at 1.00 atm is heated from 30.0°C to 40.0°C. Round your answer to the nearest hundredth.

Which city in Texas is called the “rose capital of the world”? a. Tyler b. Dallas c. Texarkana d. San Antonio Please select the best answer from the choices pro

Classify the following triangle. Check all that apply.

a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?