montgomerybunston montgomerybunston
  • 22-09-2020
  • Biology
contestada

a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

Respuesta :

oceanbluewater3000 oceanbluewater3000
  • 22-09-2020

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

Answer Link

Otras preguntas

What percent is x of y? Remember answer in percent(%)
State one importance of photosynthesis
which amendment allowed men to vote regardless of race?
Please help! Will give 50 points!!
hey can someone help me with this please ​
Examine this set of ordered pairs. (2,5), (8,9), (11,6), (18,2), (7,9) Is the set of ordered pairs a function?
what is the most populated city in the united states
How do you multiply a decimal into a fraction
If Dr Oz Sleep gives 10 off coupon on its mattresses then what's one of them's mattress price of purchase, The original price is $899?
answer and please show the work.​