laylasmessages laylasmessages

26-01-2022
Mathematics

contestada

Use algebraic operations to solve the equations.

a. 1/3z = -2
b. 6y = 3

Respuesta :

saraalvi00 saraalvi00

26-01-2022

Answer: A (-1/6) B.(1/2)

Step-by-step explanation:

a. 1/3z=-2

1=(-2)(3z)

1=-6z

(-1/6)=z

B. 6y=3

y=3/6

y=1/2

Answer Link

Otras preguntas

What are the six factors that determine feeding of rabbits?

Corvette Acceleration The following table shows the times that it takes a 2008 Corvette to reach speeds from 0 mph to 100 mph, in increments of 10 mph after 30

Explain the danger leaks pose when operating a tractor.

Please post detailed answers to the following questions. Please use complete sentences. Have you ever seen a theater performance (such as a school, community, o

Elephants can walk 5 kilometers in an hour. If a herd of elephants walks for 8 hours, how far will they have gone?

On Tuesday, Hayley only has 15 cups of flour and 9 eggs, but she has more than enough butter and sugar. Which system of linear inequalities can Hayley use to mo

turn the following into reported speech mr jones said i need to buy a present for my wifemr jones said

if i has 90 apples i ate 9 but 1 more in then ate three hou much do u have

A grasshopper jumps from (4, 0) to (20, 0), where the x-axis represents horizontal distance and the y-axis represents the vertical distance from the ground, for

2. You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’. template DNA 3’ CCTACGGTTCGTACCCCGTA