studentinquiry studentinquiry
  • 23-03-2021
  • Biology
contestada

2. You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’.

template DNA 3’ CCTACGGTTCGTACCCCGTATGTGTAACTTGTCAT 5’

Respuesta :

181103
181103 181103
  • 23-03-2021

Answer:

DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’.

Explanation:

Answer Link

Otras preguntas

whats 5y for y =23 helppp
A submarine can detect an approaching enemy submarine using sonar. If a stationary submerged submarine emits a 100kHz tone and receives a tone Doppler shifted b
what was the war on poverty
using pseudo-code, describe a recursive algorithm to find n! mod m, when m, n ? Z+.
3axy+b=c solve for a
How do you say snow in French?
I have this question...​
Galileo estimated the height of lunar mountains by: (A) measuring the height of clouds around the mountains (B) measuring the wavelength of light rays in his te
Are natural numbers rational? Show why or why not.
When 224-nm light falls on a metal, the current through a photoelectric circuit is brought to zero at a stopping voltage of 1.84 V. What is the work function of