neisharamos neisharamos
  • 21-11-2017
  • Mathematics
contestada

Subtract -6 4 -6 0 6 4 - -5 5 -4 -1 6 -4

Respuesta :

DragoniteDream
DragoniteDream DragoniteDream
  • 21-11-2017
Do you mean, -6 - 4 - -6 - 0 - 6 - 4 - -5 - 5 - -4 - -1 - 6 - -4?

If so, here's my working out:
-6 - 4 = -10
-10 - -6 = -4
-4 - 0 = -4
-4 - 6 = -10
-10 - 4 = -14
-14 - -5 = -9
-9 - 5 = -14
-14 - -4 = -10
-10 - -1 = -9
-9 - 6 = -15
-15 - -4 = -11

The answer is -11.
Hope this helps!
Answer Link

Otras preguntas

You need a shelf for a small space in your house, so you make a measurement with your meter stick and head to the store. Once there, you find that the dimension
The prisoner who wore glasses make inference about why Brille stands up to hannetjie
Simplify 2^6 X 2^9 / 2^4 x 2^2 leaving your answer in index form.
according to the christian tradition in what ways are human beings made in the image of god?
Please help!! Will make brainiest. Q5. A and B - what would the correlation look like? Thanks so much.
Ava bought a pair of earrings. The earrings are fragile. The earrings are expensive.
Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I
“ Guatemala : Bodies for Bananas”
Solve for 0 2cot^2 3x=7 cosec 3x -5
A particle is projected vertically upwards with a velocity U. After an interval of time t another particle is projected upwards from the same point and with the