Seudónimo Seudónimo

23-10-2015
Mathematics

contestada

Jason earned $187 for 17 hours of work.How much did Jason earn per hour?

Respuesta :

Аноним Аноним

23-10-2015

if he worked 17 hrs for 187. it is saying how many groups of 17 are in 187. so 187/17 = $11 per hour

Answer Link

Otras preguntas

The term biology comes from the Greek word bios, meaning _____, and the noun ending -logia, meaning ?

If a man has type ab blood and his wife has type o blood what is the probability that they have a type o child

Select all that apply. Greenhouse gases _____. absorb solar energy absorb carbon dioxide release carbon dioxide are released during the combustion of fossil f

which of the following modern technologies has most improved the ability to track changes in deserts and forests A. desalinization B. satellites C. social media

Why do you suppose the amounts of depreciation expense and interest expense are so high for gerrard construction co?

The pulmonary veins are the only veins that carry what type of blood?

If private property rights were established in the air, there would probably be

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

Describe the general process of wind generation and how it relates to the sun's energy.

If one of the station models were to show that the barometric pressure was steadily dropping and the current weather conditions showed a light drizzle with a te