thelawnooomech
thelawnooomech
25-09-2017
Mathematics
contestada
solve for x −1/2(x+2)+11/2x=3
Respuesta :
Queenbabybunnyboo
Queenbabybunnyboo
25-09-2017
The answer to this problem is 4/5 Hope I helped!
Answer Link
VER TODAS LAS RESPUESTAS ( 62+ )
Otras preguntas
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Dree rolls a strike in 6 out of 10 frames of bowling. What is the experimental probability that Dree will roll a strike in the first frame of the next game? Exp
---------- is the ability to do an activity for more than a few minutes. What is the blank?
which of the following expressions is equal to 1? a. 5^0 x 6^-3 x 6^3 x 5^1 b. 5^2 x 6^-2 x 6^3 x 5^-3 c. 5^2 x 5^-2 x 6^0 x 6^2 d. 5^-1 x 6^5 x 6^-5 x 5
1) A fashion designer makes and sells hats. The material for each hat costs $5.50. The hats sell for $12.50 each. The designer spends $1400 on advertising. How
The inferior hypogastric plexus is the site of synapse between sympathetic preganglionic and postganglionic neurons for: a. Part of the foregut b. All of the fo
Explain how the delay in marching through Belgium helped France to Survive.
Eleven members of the Middle School Math Club each paid the same amount for a guest speaker to talk about problem solving at their math club meeting. They paid
PLEASE HELP A company charges $13 plus $3 per hour to rent a boat. Abigail and Monique want to rent a boat but do not want to spend more than $20 each. What is
A cubic centimeter holds 1 milliliter of liquid. How many liters of water to the nearest tenth are required to fill a fish tank that is 24 centimeters high, 28
