katskelton16 katskelton16
  • 25-08-2017
  • Biology
contestada

What effect does food color have on what food fish eat

Respuesta :

jrocklittle3051 jrocklittle3051
  • 25-08-2017
if they see something red or black they may not eat it so yeah or if im right or wrong
Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
What type of triangle is this?
What are the three differences between The Quran and the Gospel??
Animals with cephalization usually have Select one: A. radial symmetry B. only 2 germ layers C. bilateral symmetry D. a digestive cavity with a single opening
In a parking lot there are motorcycles and cars. You count 98 wheels, and your friend counts 30 vehicles. How many cares are there? How many motorcycles? Assign
What does the term human rights mean
John Locke would have agreed with all of the following statements EXCEPT:
which of the following does NOT describe the process of summation? a. Two ESPSs are generated at the same time by two separate synapses, bringing the cell to th
ex 5 ,,,pleaseeeeeeeeeeeeeee,,,help mee ,,,
How can an iceberg (temperature=0 Celsius) have more energy than a burning match head (temperature=230 Celsius)?