amillion1882 amillion1882
  • 23-08-2017
  • Social Studies
contestada

Of the nrem sleep stages, stage _____ is the longest for people in their early 20s.

Respuesta :

andriansp andriansp
  • 30-08-2017
The answer for this question is: Stage 2
Stage 2 of the NREM sleep usually happen for about 20 minutes, which cause the body temperature of the subject to drop.
If the subject already enter this stage, it will become a lot harder to be woken up because it almost come nearer to the deep sleep state.
Answer Link

Otras preguntas

what were the three main reasons the British colonies were settled?
Please help, the question is; Complete the sentence below by writing a fraction (in its simplest form). 1/7 is half of
HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT
Worms bacteria and fungi help the ecosystem by________ dead organisms
6 Atoms of carbon, 12 atoms of hydrogen, and 6 atoms of oxygen. What’s the empirical formula of this? I also need an explanation
1. Understand and define adaptation and adaptive evolution 2. Explain convergent and divergent evolution Describe homologous and vestigial structures 3. Expla
Where could point E be if BCDE and D is between E and B? A. -1 B. 0 C. 1 D. 2
What is a main way that Co2 is used
the message was written by the marketing manager of an online retailer of baby related products in the hope of becoming a retail outlet for Inglesina strollers
When one molecule collides with another energy is transferred from one molecule to another and both molecules experience what