Alzeeekatimalazar Alzeeekatimalazar

26-02-2017
Mathematics

contestada

If 25 roses are $37.50 what is the amount for each rose

Respuesta :

Аноним Аноним

26-02-2017

$37.50 divided by 25= $1.50...
hope this helps!

Answer Link

Otras preguntas

Write the expression 3 log(x-2)+log(x+2)-log(x^2-4) as a single logarithm.

When did Chandragupta Maurya establish a huge empire over most of the Indian subcontinent? Select the best answer from the choices provided. A. In the prehisto

Sean scored 48 points in 16 basketball games last season. Approximately how many points did Sean average per game?

1. Over time the economy of Europe changed from one based solely on agriculture to one focused more on trading and the merchant class, why did this transition t

Which colony banned slavery at first? Georgia Maryland South Carolina North Carolina

What is negative 4 mins positive 4

Your best friend always looks on the bright side ands is very positive, your friend has which positivitey trait

What are the dimensions of a 72in television with a 16:9 aspect ratio

DNA tacaggtacccgaacccaattta

Tito bought a rare album for $68.00 and later sold it for $76.00 what is the percent of increase , rounded to the nearest tenth?