mtsimmons77 mtsimmons77
  • 25-10-2022
  • Mathematics
contestada

Solve k over negative 1.6 is greater than negative 5.3 for k.
k > −8.48
k < −6.9
k > −6.9
k < 8.48

Respuesta :

Otras preguntas

what is the pural form of l'interro
Between the bold lines on a food label is the bformation for serving(s) A. 2 B. 3 C. 1 D. 0
In your opinion, what should a government do for their people?
a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
Constance is saving money to buy a new bicycle that costs $205.75. She already has $80 saved and plans to save $8 each week. How many weeks will it take her to
Which type of error occurred in the following lines of code? >>> print("Good Morning") SyntaxError: unexpected indent logical error reserved word erro
which function is the inverse of f(x)=2x+8
Find the value of x. 42° 130° 75°
Explain what the difference is between THEME, Main Idea & Summary.
It takes a student 12.0 minutes to get home from school while riding their bike at 6.7 m/s. What distance (in km) did the student travel? *