juliekobelev juliekobelev

23-06-2022
Mathematics

contestada

PLEASE HELP!!!!

Which operation should you perform last in the expression 3^2 + 2?

Respuesta :

Аноним Аноним

23-06-2022

Answer: the +2

Step-by-step explanation: PEMDAS. Exponents are before addition in the sequence. I hope this helps!

(The E standing for exponents and the A standing for addition)

Answer Link

Otras preguntas

Which of the following is an example of a “smart” exercise choice? Wear extra layers of clothing Swim where a lifeguard can see Prepare large meals beforeha

Find the smallest zero for the function h(x) = 4x^2 - 8x - 60

The gradient of a stream depends on its

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

which of the following is a general way to describe the base pairing rules for DNA

What the the equation -984-n=-285 what does n equal

A cylindrical can of cat food has a diameter of 3.5 inches and a height of 1.25 inches A second brand of cat food is packaged in a cylindrical can with a radius

list the six external parts of a computer system and identify which are output and which and which are input devices

1.What process is used to replicate the chromosomes? 2.Are the sister chromotids genetically identical? Explain.

how are the four earths systems connected