ajasbusiness ajasbusiness
  • 22-06-2022
  • Mathematics
contestada

I need help please! What’s the answer?

I need help please Whats the answer class=

Respuesta :

jsimpson11000 jsimpson11000
  • 22-06-2022

Answer:

x =  17.32 units

Step-by-step explanation:

In a right triangle tan (angle) = opposite leg / adjacent leg...

  for this triangle   tan 27° = 34 / x

      then x = 34 tan 27° = 17.32 units

Answer Link

Otras preguntas

How many cm has a inch
I need help please what are some negative effects of stress on an individual? For this discussion, I would like everyone to explain how stress affects an indivi
when addressing an envelope for delivery in the united states or canada, the zip code should appear where
Helpp Pleasee ASAPPPPP
E. coli (K12) has a genome size of 4,639,675 bp in one chromosome that encodes for 4,435 proteins. The average size of these proteins is 330 amino acids. What p
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
what is the property of 6x=72
What is double consciousness
which of the following are solutions to the equation below? check all that apply. x^2+6x+9=6 A. x=3+√6 B. x=3-√6 C. x=3 D. x=0 E. x=-3+√6 F. x= -3-√6
Select all that apply. Select all the correct statements about ion sizes below. Check all that apply. Au3+ is smaller than Au+ As3− is smaller than P3−. Au+ is