imheretohelpyou1 imheretohelpyou1
  • 22-01-2017
  • Mathematics
contestada

hhhheeeellllpppp plllleeeeaaassee

hhhheeeellllpppp plllleeeeaaassee class=

Respuesta :

Blanablas
Blanablas Blanablas
  • 22-01-2017
100 yds, 2 inch x 20 yards = 80, round up to 100
Answer Link
Veronikabrooke Veronikabrooke
  • 15-05-2021

Answer:

100 yds, 2 inch x 20 yards = 80, round up to 100

Step-by-step explanation:

Answer Link

Otras preguntas

Calcula el valor de la tensión de la cuerda y la aceleración de las cajas de acuerdo con la siguiente imagen:
what are the rules for dividing integers
How might colonial government have evolved differently if the colonist had not chosen to follow these traditions and laws? PLEASE HELP ME
PLEASE HELP ASAP!!! Will give 15 points!!
What are the factors that society should take into account when weighing the costs and benefits of regulating a product— such as marijuana, alcohol, and tobacco
whats the answer ?????? simplify 5x5squared
i need help with 8-11
Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I
Use graphing technology to find the range of the function f(x) = -(x - 5)² + 4.​
hi sex.................​