whitedemon029 whitedemon029

25-10-2021
Mathematics

contestada

I have more question just don't get it wronge

I have more question just dont get it wronge class=

Respuesta :

joshuaeapen22 joshuaeapen22

25-10-2021

Answer:

Relfection over the x axis

Step-by-step explanation:

It is the name shape but flipped onto the other side, therefore it is a reflection

Answer Link

Otras preguntas

Sound travels at a rate of 340 m/s in all directions through air. Matt rings a very loud bell at one location, and Steve hears it some time later at his locatio

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

What do they mean when they say, "Society pays for the end results of alcohol abuse"? Do they mean that the person who consumed it pays the consequences or lite

In a monohybrid cross, F2 refers to __________. A)the original mating pair B)the grandparents of the 1st generation C)the 1st filial generation D)the second fil

Which of the following is a danger of exercising in cold temperatures? A. Dehydration B. Hypothermia C. Stroke D. Irritability

Explain why 2.15 and -2.15 are are opposites?

Write a recursive function for this sequence 8,12,18,27..

What did Anti-Federalists fear would happen if the Constitution became law?

How many howl ones are equal to 36 quarters

find three acids and three bases used in your home. 1) what are theses acids and bases used for? 2)look up the chemical name and chemical formula of each acid a