slb7301 slb7301

22-10-2021
Mathematics

contestada

3(0.5 - p) - 4(p - 0.75); p = 2

Respuesta :

26ocazares 26ocazares

22-10-2021

Answer:

Negative 9.5

Step-by-step explanation:

3(0.5 - 2) - 4(2 - 0.75)

3(-1.5) - 4(1.25)

-4.5 - 5

-9.5

Answer Link

Otras preguntas

scientists might make more inferences when drawing __.

Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I

Juice is made using cordial and water in the ratio 1 : 4. How much juice can be made with 40ml of cordial

In paragraph 4, what does Jefferson say about the treatment of the colonists under the king of Great Britain? According to Jefferson, what justifies a revolt ag

What is the range of the function graphed below?

9 7/8 - 2 3/8 = 24 4/5 - 6 3/5 = 29 5/12 - 3 1/12 = 57 7/8 - 48 = ILLL GIVE BRAINLIST PLPSSPSLPSLSPSLSSLSLSLSSLLS<3

How many nickels makes 12 dollars?

disscuss the feeling and emotion of the central character if the poem A Red palm by garay soto

Complete the chart below with information from the lesson. The name of the first empire covered has been added to the first column. Geographic location/region D

DVD, in full digital video disc or digital versatile disc, type of optical disc used for data storage and as a platform for multimedia