tram31322 tram31322
  • 23-09-2021
  • English
contestada

Trainee Accountants: Accountants who are ___________ for professional examinations
studying
researching
hiring
working

Respuesta :

carolina081603 carolina081603
  • 23-09-2021
researching is the best answer
Answer Link
oddie2002 oddie2002
  • 23-09-2021
Researching is the answer
Answer Link

Otras preguntas

Nathan is buying a cell phone for his business. The regular price of the cell phone is $179. If he buys the phone in the next 2 weeks, he will get a 20% discoun
Tell whether the given value is a solution to the inequality. -2.4m>-6.8;m=-3
. Slope intercept for y minus 3x equals 19
A number triple and tripped again is 729 what is the number show workings
choose the correct helping verb the tadpoles have or had moved into the pond
what Is the difference between organic and inorganic matter?
Which verb form correctly completes the sentence? Is the verb singular or plural? The boy with the red shirt and blue jeans __________ been his friend since h
what are the chromosome numbers of daughter cells in mitosis and meiosis
Convert 2x - 3y + 1 = 0 to slope-intercept form
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC