980086227
980086227 980086227
  • 26-08-2021
  • Biology
contestada

How many centiliters are in one liter?

Respuesta :

Cutieky003
Cutieky003 Cutieky003
  • 26-08-2021

Answer:

100

Explanation:

1 liter = 100 centiliter

Answer Link

Otras preguntas

The radius of the planent venus is nearly the same as that of the earth,but its mass is only eighty percent that of the earth. If an object weighs w on the eart
omega 3 fatty acids are important because they
if an element has more than one ionic change how is that piece of information represented in the chemical name
Identify the parts of the human body that normally contain bacteria
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
1.True or false: It may be possible to save a significant proportion of Earth's biological diversity by establishing sustainable biological reserves at 25 locat
a solution of 0.10 hydrochloric acid, HCL is a better conductor of electricity than 0.10 M acetic acid, CH3COOH. sketch the ions and molecules in both solutions
What does the equation -355-n=-957 what does n equal?
Who is Christina LeConte
Explain the relationship between osmosis and aquaporins.