DN445
DN445 DN445
  • 24-06-2021
  • Social Studies
contestada

Fun fact there's a village named “sus” southwest France.

Respuesta :

Melody08
Melody08 Melody08
  • 24-06-2021

ohhh I see interesting:))!!!!

Answer Link
dragongon77
dragongon77 dragongon77
  • 24-06-2021
Omg I had to look it up I’m moving to sus now
Answer Link

Otras preguntas

Hydrogen peroxide decomposes to give water and oxygen gas according to the equation below. If 3.0 moles of hydrogen peroxide decompose, what volume of oxygen ga
Suppose scientists found parts of the DNA from a dinosaur. What info would this discovery provide? What info would it not give them?
what is the property of 6x=72
the surface of water connect like a sort of sort of skin due to property of liquids called
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Explain lt Explain why the formula for finding the surface area of a rectangular prism is helpful. I NEED HELP !
PLEASE HELP ME AASSAPP
find three acids and three bases used in your home. 1) what are theses acids and bases used for? 2)look up the chemical name and chemical formula of each acid a
what does hafa adai mean in guamanian
87.5 of what number is 315