navinasattie2007
navinasattie2007 navinasattie2007
  • 24-05-2021
  • Mathematics
contestada

What is 2 15/16 Ian’s a decimal?

Respuesta :

nsrosewine nsrosewine
  • 24-05-2021

Answer:

2.9375

Step-by-step explanation:

15 divided by 16 equals .9375 so 2 15/16 is 2.9375

Answer Link

Otras preguntas

A storage unit is in the shape of a cube with 8 feet edge lengths what is the surface area of the storage unit
Does this represent a linear function?
What happens as genes are passed on from parent to offspring over many generations?
A single stranded DNA has a base sequence of 5'GACTCCGTAACGGTTAACC3'.What DNA sequence will base pair
1. Obligate anaerobes are often grown in an anaerobe jar, which completely excludes oxygen from the environment. How is the environment within a tube of fluid t
6. Why is crossing over, or recombination, in meiosis a genetic advantage for a n organism? Why is crossing over an advantage for a geneticist
tips para perder el miedo a un sismo o terremoto y planes de evacuacion como el triangulo de la vida y kits de emergencia
What happens as genes are passed on from parent to offspring over many generations?
In hexagonal writing and analysis of literary devices explores
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC