marnatalie02 marnatalie02
  • 21-05-2021
  • English
contestada

what type of humor is this

what type of humor is this class=

Respuesta :

jacksonjamyelah18
jacksonjamyelah18 jacksonjamyelah18
  • 21-05-2021

this humor is anecdote.............

Answer Link

Otras preguntas

Cardiac muscle contracts A. in response to voluntary output B in response to nonvoluntary input C. on its own without input
which of the following are solutions to the equation below? check all that apply. x^2+6x+9=6 A. x=3+√6 B. x=3-√6 C. x=3 D. x=0 E. x=-3+√6 F. x= -3-√6
If 1+4=5 and 2+5=12 what does 8+11=
what is the solution to the following equation? 9x^2-12x+4=17
A 54.2 L sample of gas at 115 K is heated to 345 K, at constant pressure. What volume does the gas now occupy?
What do they mean when they say, "Society pays for the end results of alcohol abuse"? Do they mean that the person who consumed it pays the consequences or lite
Can anyone to correct it if necessary? Thank you.
you just bought a new hard drive for your computer, you plan to use this secondary hard drive to store all school work files. once installed, what needs to be d
how are the four earths systems connected
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC