tanyasingh21 tanyasingh21

26-03-2021
Biology

contestada

Help me plz asap 2-4 plz

Help me plz asap 24 plz class=

Respuesta :

annaclaire946 annaclaire946

26-03-2021

Answer:

1.mRNA- ATGAAAAGGTCCGTGGGAACTAAACAACACTAA

2.MRNA- ATGAAAACGGTCCGTGGGAACTAAACAACACTAA

3. ??

4. It will affect the protein so the leg wont have enough protein or have too much.

Explanation:

Answer Link

Otras preguntas

How did the relationship between Britain and colonies fall apart

In about 5 billion years, at the end of its lifetime, our sun will end up as a white dwarf, having about the same mass as it does now, but reduced to about 15,

The perimeter of the triangle is 4x+3y. Find the measure of the missing side.

20 pounds plus 7 ounces equals how many ounces

. Every preposition must have a/an a. subject. b. object. c. pronoun. d. comma. user: the comparative form of adjectives compares a. more than two things o

if a theatre holds 1,200 people, and sells 2/3 of its seats, how many tickets does it sell?

the train accelerates from 30 km/h to 45 km/h in 15 secs. a. find its acceleration. b. distance it travels during this time ...?

what role did technology play in the scientific revolution?

A carpenter has 166 doorknobs in his workshop. Of those doorknobs, 98 are round and the rest are square. If he wants to place 7 square doorknobs in each bin, ab

A harsh climate with rocky soil best describes the environment of a. the southern colonies. c. the New England colonies. b. the middle colonies. d. the West Ind