trivera0012
trivera0012 trivera0012
  • 25-03-2021
  • Mathematics
contestada

The jaguars scored 37 points their first game. They scored 58 points their second game. What is their percent change?​

Respuesta :

PiaDeveau PiaDeveau
  • 30-03-2021

Answer:

Change in percent = 56.75 (Approx.)

Step-by-step explanation:

Given:

Score in first game = 37 points

Score in second game = 58 points

Find:

Change in percent

Computation:

Change in percent = [(Score in second game - Score in first game)/Score in first game]100

Change in percent = [(58-37)/37]100

Change in percent = [(21)/37]100

Change in percent = 56.75 (Approx.)

Answer Link

Otras preguntas

how can you solve problems with ratioal numbers
true or false? Among Quakers, the women could speak as freely as men and were seen as equals in religious meetings.
Solve p^2a=p^2e+r for p.
which reason is not typically used in proof
An important battle took place between June 3, 1942, and June 7, 1942. The battle resulted in an hour and victory over Japan and kept Hawaii safe from the anoth
DNA tacaggtacccgaacccaattta
equation perpendicular to x+2y=-4 with a point of (-8,5)
if a liter of water is heated from 20 degrees C to 50 degrees C what happens to its volume
As a pendulum swings back and forth, its total energy is 16 J. What is its kinetic energy at 3/4 its maximum height? A. 4 B. 5
I have 3 questions I need answered ASAP please :) Complete the following question: ___ du gern Freunde? Bist Ist Besuchst Besucht Comple