lillypadforfrogs2020 lillypadforfrogs2020

24-03-2021
Arts

contestada

Does this picture use the rule of thirds?

Does this picture use the rule of thirds class=

Respuesta :

kiarafloress80 kiarafloress80

24-03-2021

Answer: no ideass but ye

Answer Link

Otras preguntas

4. PCR Primer design (4 points) You have a piece of DNA that includes the sequence: 5'GATGAGGATGAGGAGAAGTACCGGCCGCCGCCTGCGCATCACAATATGTTCAGT 3' To amplify this

Parallel and Perpend Mathematics for Data and Financial Literacy Sem 1 3.3.3 Quiz: Parallel and Perpendicular Lines Question 2 of 10 If two lines are parallel,

A 0.0516 kg ingot of metal is heated to 236°C and then is dropped into a beaker containing 0.371 kg of water initially at 20°C. if the final equilibrium state o

Which of the following did Sandra Moriarty note as informal techniques to become familiar with a product for the purposes of marketing it? A. Reading product li

A disease-resistant variety of a sexually reproducing crop was planted on a field with an existing nonresistant variety. After a few years, pests severely attac

The economy of Quarterville has an M2 equal to $5000.00. If money market funds total $100.00, savings accounts total $2000.00, and time deposits total $330.00,

Which forms as a result of congressional stress?

What type of observation involves the researcher studying participants in a laboratory in full view of the participants?

any help solving this problem would be appreciated. Thank you

The velocity of a moving particle is given as v square is equals to 2 x square 4 x find the acceleration at x = 5