avap1203 avap1203

23-03-2021
Mathematics

contestada

Which is the equation of the line that passes through the points (-4, 8) and (1, 3)

Respuesta :

MrAnswerss MrAnswerss

23-03-2021

Answer:

(-4,8)

Step-by-step explanation:

Have a NICE day!

Answer Link

Otras preguntas

the primary organic source of energy for living things are

Can you pleas help me solve this assignment?

Which naval battle forced the German high seas fleet to its harbor and this helped turn the war in favor of the allies

Animals with cephalization usually have Select one: A. radial symmetry B. only 2 germ layers C. bilateral symmetry D. a digestive cavity with a single opening

What is a telomere? What happens to telomeres each time DNA is replicated? How do cells prevent this from occurring?

The tube that connects the bladder and the outside is called the

Which of the following can increase your credit cards APR

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

A department store purchases a dress for $80. To sell the dress to customers, the price is marked up by 19%. You hand the clerk $110. How much change will you

A survey shows that 67% of peanut butter lovers prefer chunky style. Out of 850 people surveyed hoe many can be predicted to say they prefer chunky style peanut