robloxrobux012
robloxrobux012 robloxrobux012
  • 23-01-2021
  • Physics
contestada

What is Church In Your Own Self?

Respuesta :

sweey42
sweey42 sweey42
  • 23-01-2021

Answer:

church is a scared place of Catholics ,where Bible is read and is explained with a meaningful sermon. In church mass are been held with Psalm, prayers , intentions and much more. Priest along with parishioners are present in this mass .

Answer Link

Otras preguntas

This is one of the phases of Mitosis. P 7 Vuv w What is happening to the chromosomes?
Why did the Catholic Church support the study of science? They wished to learn more about God. They wanted to find a different way to worship. They wanted to p
Most seals are gray or brown? fact or opinion plz help
pls help 11111111111111
In fish, having two fins (F) is dominant over having pne fin (t). Complete the punnett square to show a cross between a heterozygous two finned fish with a one
What is the simplified value of the exponential expression 27 Superscript one-third? 3 9
Please complete the following DNA strands 1. AGGTCCAAGCTCAAATTTCCCC 2. GAAACCCCTTAAACCTTAATTCC 3. GCGCGCGCAAATTTTTCCCATCT Please complete the following strands
3. The car's mass is 400 kg. It moves at a velocity of 20 m/s. Calculate the car's momentum. * (10 Points) 0.05 kg.m/s 8000 kg.m/s 80,000 kg.m/s 20 kg.m/s
Please help me I will give brainly
giving brainliest !!!!!