Seudónimo Seudónimo
  • 22-01-2021
  • Mathematics
contestada

help me plzzzzzzzzzzzzzzzzzzz

help me plzzzzzzzzzzzzzzzzzzz class=

Respuesta :

robhu2015
robhu2015 robhu2015
  • 22-01-2021

Answer:

3p=1/2

Step-by-step explanation:

3 p's balance with 1/2 making them equal

Answer Link

Otras preguntas

Electrons are in ___________ ___________ surrounding the nucleus.
The following program results in a compiler error. Why? int FindMin(int a, int b) { int min; if (a < b) { min = a; } else { min = b; } return min; } int main
7 less than 4 times y
Why would a boy ask you if you know how to make out???I just regular kisses and he said do you know how to make out?? Answer ASAP
como se dice "lets finish the scene" en espanol? A. Terminen la escena. B. Terminas la escena. C. Termine la escena. D. Terminemos la escena.
What is the 5th term in the geometric sequence described by this explicit formula? an = 30 • (-2)(n-1)
What is one quality of a strong research question? A. The question explores various sides of an issue. B. The question can be answered with “yes” or “no.” C. Th
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provid
An airplane is traveling at 940 km/h. How long does it take to travel 2.00 km?
The first and second coils have the same length, and the third and fourth coils have the same length. They differ only in the cross-sectional area. According to