Jawbreaker220 Jawbreaker220

25-10-2016
English

contestada

How does self-esteem affect one’s ability to communicate?

Respuesta :

Gamecount Gamecount

18-12-2020

Answer:

People with low self-esteem have troubles talking to others because their more focused and worried about what the person their talking to thinks of them, rather then being free to say what they want to and being them-self.

Explanation:

:)(:

Answer Link

Otras preguntas

Joan drives 333.5 miles before she has to buy gas. Her car gets 29 miles per gallon. How many gallons of gas did the car start out with?

The act of financing one's business by using real personal assets is known as

y> 2x-3 graph the linear inequality

Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I

I need help with #40

Marco went to Buffalo Wild Wings to watch a football game. Chicken wings there cost $0.75 each. Marco bought and ate 20 chicken wings. Afterwards, he regretted

16 Select the correct answer. explains that an individual will change his/her behavior only if they want to change. O A. The decision-making model OB. An action

Identify the following words with its functions. “The engineers and the conductors went to dinner.” Choices to choose from: Verb _________ Subject _________ Sub

Simplify the expression

Place the events in the correct order, from earliest to latest: A. Kristallnacht, Civil Service Law, Meeting at Wannsee B. Meeting at Wannsee, Civil Service law