e7meyannuLi e7meyannuLi

24-10-2016
Chemistry

contestada

If a large chunk of sulfur is ground into powder, its mass will ___

Respuesta :

Jebbrey Jebbrey

24-10-2016

its mass will stay the same

Answer Link

Otras preguntas

64PT AND BRAINLIEST! Which of the following would produce a graph with no solution? | x | = − 5 | x | < 5 | x | < 5 | x | = 0

What is the gradient?

Bell help help help math math

A T-shirt company charges $4 per T-shirt, plus a flat shipping fee of $5. Terry bought some T-shirts. How can you write an algebraic expression to represent the

The length of a rectangle is 6 inches more than 4 times its width. A similar rectangle has a length of 18 inches and a width of 4 inches. What is the area of th

In a chain of consequences after a forest is cleared, what is an immediate, direct impact? O habitat is destroyed O the greenhouse effect increases O species go

please help me on this

Ron wants to make money painting portraits of people at the local mall. The mall charges Ron $22.00 a day for Ron to set up his materials to sell his portraits.

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

PLEASE HELP ME!!! GIVING BRAINLIEST