montecinosvaler montecinosvaler

23-11-2020
Health

contestada

What symptom is an indicator of nicotine withdrawal?
water retention
muscle twitching
chronic headaches
musculoskeletal system

Respuesta :

Charlottepate Charlottepate

10-12-2020

Answer:

I think it would be chronic headaches

Explanation:

I hope this helps!

Answer Link

Wallacemarquis553 Wallacemarquis553

18-02-2021

Answer:

c

Explanation:

edg 2021

Answer Link

Otras preguntas

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

which of the following is an example of low contex culture

the name of this fatty acid is caprylic acid :CH3(CH2)6COOH ??

Where is 0.5 on the graph? I have to do ( 0.5, 4)

In Saudi Arabian currency 1 riyal equals 20 qurush. Sheik Ahab had 15 coins whose value was 205 qurush. How many coins of each kind were there?

May anyone give me 3 points that I could include in my paragraph ( I agree with the statement) I need more ideas?

How did disease affect the civil war troops?

1 minute is equal to 60 seconds. How many seconds are in 3 minutes, 37 seconds?

Which of the following lines are perpendicular to the line y= -1/2x +4 ? (you may choose more than one answer) A. 2x - y = 1 B. y = 2x C. 2x + y = 1 D. 1/2x - y

what method is used most frequently to investigate the structure of sediment and rock layers of the sea floor