nanaasiedukotwi
nanaasiedukotwi nanaasiedukotwi
  • 22-11-2020
  • English
contestada

give two synonyms of pulcritidinous​

Respuesta :

Alondra1101
Alondra1101 Alondra1101
  • 22-11-2020

Answer:

admirable, alluring, are 2 synonyms or beautiful and pretty

Answer Link
MAXLOPEZ3214 MAXLOPEZ3214
  • 22-11-2020

Answer:

admirable, alluring, are 2 synonyms or beautiful and pretty

Explanation:

Answer Link

Otras preguntas

Saleema was investigating the newspaper subscriptions for her local newspaper. At the beginning of the year, She noted 1000 subscriptions for Subscribed to the
Which of the strands of DNA could act as a primer for the DNA sequence shown below? 5 ' CCCTGGGCTCTGTAAATGTTTCTAAGTG -3' 3' GGGACCCGAGACATTTACAAAGATTCAC -5' A:
Please help Factor w2+16
If a class named Student contains a method setID() that takes an int argument, and you write an application in which you create an array of 20 Student objects n
Question 1. Question 2. Consider the point and line below. Point Line (-7,3) x + y = 2 Exercise (a) Write an equation of the line through the point parallel to
Create an example that will show and explain the difference between - band b-1
Effectiveness and ineffectiveness of south africa n human right commission that deal with human rights Violations​
what condition describes difficulty breathing unless in an upright position
Why, do you think, were the Montague-Chelmsford reforms not very popular
CAR PARK $6.00 per hour or part thereof Susan parked her car in Eastern Car Park at 10:20a.m. and returned for it at 4:15p.m. Calculate how much Susan will pay