griffgen000
griffgen000 griffgen000
  • 21-10-2020
  • Mathematics
contestada

Solve for x and explain how you use inverse operations to find your answer:
8x=2

Respuesta :

karen09132105 karen09132105
  • 21-10-2020
0.25 , because you divide 2 by 8 so that’s how you are using the inverse operation
Answer Link

Otras preguntas

What are the differences between the 54th and the black troops they meet in South Carolina?
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
QUESTION 22 PLEASE HELP ME!!!!
How can you find approximations of square roots?​
Gross motor skills: A) are movements that involve a series of muscle groups that are dependent on eye coordination, timing, precision, and tracking. B) are the
N order to create imagery that appeals to the reader’s senses, an author must make careful word choices. Which words from the poem best create sensory images? s
________ refers to the function of a body part, while ________ refers to the structure of a body part.
1.(01.01) Evaluate -6 - (-1). (1 point) 5 -5 6
connect description with definition
Estimate the quotient. 2,506 / 2