c0anna5messjohnsk c0anna5messjohnsk

23-09-2016
Chemistry

contestada

Each nucleotide triplet in mRNA that specifies a particular amino acid is called a(n) mRNA: CUCAAGUGCUUC
A ) peptide bond.
B ) codon
C ) helicase

Respuesta :

mpanderla95 mpanderla95

24-09-2016

Each nucleotide triplet in mRNA that specifies a particular amino acid is called an mRNA codon.

Answer Link

Hussain514 Hussain514

26-09-2016

Each nucleotide triplet in mRNA that specifies a particular amino acid is called a(n) mRNA: CUCAAGUGCUUC is CODON.

Answer Link

Otras preguntas

What is the value of z?

Which of the following statements is true regarding Laura, an individual taxpayer who dies in 2021 with a gross estate of $10,000,000? a. No estate tax will be

What length of mirror drive in a Michelson interferometer is required to produce a resolution sufficient to separate

Which Central Asian country has had political and economic clashes with Russia? Kazakhstan Uzbekistan Tajikistan Kyrgyzstan

Why do some children have more respiratory problems than others? What are some examples

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

Solve the pair of simultaneous equations x = 4 - y x = y + 2

If 3 is added to three quarter of a certain number, the result is 30.find the original number.

please help me out on this one

Your class is having a pizza party. You buy 5 pizzas Each pizz has 4 slices. How many slices is that altogether?