helenirby1964 helenirby1964

22-05-2020
Chemistry

contestada

4. Translate the following RNA sequence into a protein chain.
AUGGUUACCAGUCGCUUAUAA
Please

Respuesta :

FortniteforLifeooof FortniteforLifeooof

22-05-2020

Answer:

AUUUAAAHAHYAGHY

Explanation:

Answer Link

Otras preguntas

Simplify the expression: 1/1+cot^2x

At which of the following locations did Native Americans win a victory over cavalry troops? a. Snake River Valley c. Little Big Horn Valley b. Fort Laramie d. N

ch3c(ch2ch3)2(ch2)5ch3 naming

Why did the different religions that built the great mosque in córdoba and the church of sainte-madeleine at vézelay employ such similar patterns and rhythms in

What was the major achievement of Frances de Sales? established Catholicism in North America established Catholicism in India, Japan, and Malacca revived Cathol

What is the electron structure of an oxygen atom? A.) 1s22s22p4 B.)1s12s22p4 C.)1s22s12p4 D.) 1s12s12p4

What else would need to be congruent to show that triangle ABC is congruent to triangle DEF by ASA?

How to find horizontal range of a projectile?

Read the excerpt from "The Rosetta Stone.” Then chance stepped in. In 1798, Napoleon went to Egypt to protect its trade interests. In addition to an army, he br

Identical products, as well as a large number of buyers and sellers, are characteristics of a monopolistic market. in such markets, sellers of goods cannot infl