luvxmimi luvxmimi
  • 23-04-2020
  • Biology
contestada

Create the complement of the following DNA strand. TACCCATTACGCGGCAAGCGUAATTAC​

Respuesta :

Аноним Аноним
  • 23-04-2020

Answer:

This is the mRNA strand

Explanation:

AUGGGUAAUGCGCCUUCGCAUUAAUG

Answer Link
StephanyNo StephanyNo
  • 23-04-2020
AUGGGUAAUGCGCCGUUCGCAUUAAUG
Answer Link

Otras preguntas

How many moles are there in 3.9 grams of potassium
Which were characteristics of rule under caudillos in the Dominican Republic? Check all that apply. free trade dictatorship economic strength economic weak
Why should you always read with a purpose? O A. A purpose makes it easier to decode unfamiliar sounds. B. A purpose helps guide and focus your reading. O C. A p
-2(x-3)-2 simplify the expression
Sarah rolled two 6-sided number cubes. Find the probability that the sum of the numbers is equal to 12.
The polygons are similar. Find the value of x. A 14 F 7 R 12 13 S F 13 G 8 26 X =
Twenty pounds of bean are distributed equally into 16 bags to give out at the food bank.How many pounds of beans are in each bag?eter your answer in simplest fo
what is the major source of remittance to Nepal​
happened to the areas of eastern Europe
The right to be informed of why you are being arrested which amendment