bouchie bouchie

21-04-2020
Mathematics

contestada

9 is what percent of 60?

please show all steps, thanks

Respuesta :

Аноним Аноним

21-04-2020

Answer:

15%

Step-by-step explanation:

9/60= 0.15 = 15%

Answer Link

21-04-2020

Step-by-step explanation:

[tex] \frac{9}{60} \times 100[/tex]

=15 percent

Answer Link

Otras preguntas

Kimi and Jordan are each working during the summer to earn money in addition to their weekly allowance, and they are saving all of their money. Kimi earns $9 pe

please show work 10. If the area of a parallelogram is 690.84 m2 and the height is 20.2 m, what is the length of the base?

Don Swifter earns $9.75 per hour as a clerk. He starts work Monday through Friday morning at 8:00 AM. He takes a one-half hour lunch break every day. If he fini

Consider this diagram of quadrilateral ABCD, which is not drawn to scale.

Hi, I have a question it is kinda hard but I think i got it, if it's wrong plz tell mee Solve for X 5-x+6=4 X=3

Help please!! (The image is for all questions) 1. Complete the chart. Type your 3 responses. 2. Use 2 points from your chart to calculate the slope. formula: y

8. The circle centered at Q is a scaled copy of the circle center at R. (Lesson 3-1) גן תט a. Find the scale factor х 3 R 5 LO512 D Subo Orion V Com odnos shs o

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

Can you help me explain

I need help please I don’t know what to it is due today