esv0929 esv0929

23-03-2020
Mathematics

contestada

waffles made with 2 1/2 C of water and 1 1/2 c of milk. what is the ratio of water to milk?

Respuesta :

Stryfer Stryfer

23-03-2020

Answer:

5:3

Step-by-step explanation:

2.5 Cup of Water

1.5 Cup of Milk

2.5:1.5=0.5:0.3=5:3

Answer Link

Otras preguntas

Écrivez la bonne préposition. L'étudiant va (blank) Etats-Unis. Ma mère habite (blank)Vienne. Vous allez (blank )Asie.

How many copies of Brain Friction Wondering of the Mind by Artwoodwrite have sold

A football player kicks a ball with a force of 50N. Find the impulse on the ball if his foot stays in contact with the football for 0.01s.

If it takes Tim 10 minutes to bike 6 miles how many minutes will it take him to buy 144 miles

50 points!! Explain how the South used States’ rights to support slavery. Must be 5 or more sentences long

1 3/8+1 7/8. Cannn u plssssss hellllpppp meeeeeeee

A stream meanders across a broad, flat valley with numerous swamps and lakes. This stream is ________. running at base level or below base level running well ab

Last Sunday, we noticed that our dance show 1000 tickets were sold. For an adult, the cost of a ticket was two dollars and for a child it was one dollar. When a

Write the base sequence of the complementary strand of double-helical DNA in which one strand has the sequence (5)ATGCGTAGCCTAGCCTAGTAGCCTTC(3). What is RNA seq

1 kg air in a piston-cylinder assembly is heated at constant pressure, resulting the expansion of the volume. The initial temperature of the air was 300 K, and