tomytippie tomytippie

25-06-2016
History

contestada

the Era in which early humans made tools is called what?

Respuesta :

mimozamarku101 mimozamarku101

25-06-2016

The era in which early humans made tools is called the Paleolithic Era.

Answer Link

Otras preguntas

If a DNA template strand has a sequence of 3' TACAATGTAGCC 5', then the RNA produced from it will be which sequence? A.) 3' AUGUUACAUCGG 5'. B.) 3' TACAATGTAGCC

87.5 of what number is 315

How did the French National Assembly treated religion

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

In hexagonal writing and analysis of literary devices explores

A major cause for gender inequality is believed to be (Points : 1) economic division of labor by gender. political leadership. women’

Explain the importance of spore formation for both eukaryotes and prokaryotes.

Which of the following can increase your credit cards APR

A common way to deliver anesthesia for surgery and childbirth is to inject the anesthetic agent into the epidural space. A possible complication of this procedu

In a population of skunks, there are striped and stripeless individuals. Stripes are dominant to the absence of stripes. In this population, p = 0.8 and the fre