porfiriojrh2 porfiriojrh2

22-01-2020
Mathematics

contestada

Simplify. (8x + 5) + (4x2 - 2x - 6) A. 4x2 + 6x - 1 B. 4x2 + 10x + 1 C. 4x2 + 10x - 11 D. 4x2 + 6x + 11

Respuesta :

TheAnimeGirl TheAnimeGirl

23-01-2020

The right ans is A.hope it will help u.........

Ver imagen TheAnimeGirl

Answer Link

Otras preguntas

Can someone identify the solutions ?

How does Ultima help Antonio overcome his fear of the "presence," or the soul, of the rive

Can someone please help me answer this!

The housing and urban development act of 1965 and the fair housing act of 1968 were both aimed at

For an interest rate of 12% per year compounded continuously, find (a) the nominal rate per year, (b) the nominal rate per quarter; (c) the effective rate per q

Pure liquid water is described as neutral because the water's pH is - ОА. 8 Ов. о ООО

3 x A = 30 + 30 it’s a 3rd grade problem but don’t know the answer

Why was austria easier for hitler to annex than czechoslovakia

Write the base sequence of the complementary strand of double-helical DNA in which one strand has the sequence (5)ATGCGTAGCCTAGCCTAGTAGCCTTC(3). What is RNA seq

The Town of Red Herring issued $60,000 of purchase orders. Assume that when all orders were received, the actual cost was $59,000. How much would be recorded as