hasbrouckzackary
hasbrouckzackary hasbrouckzackary
  • 24-10-2019
  • Chemistry
contestada

An atom has a charge of +1 in its nucleus.
Which statement must be true in order for this atom to have no net charge?

Respuesta :

zishanshani2002
zishanshani2002 zishanshani2002
  • 24-10-2019
To gain an electron from any atom
Answer Link

Otras preguntas

11. The presentation was successful, so Jade and Michaela told their teacher to give them a good grade. Is this simple,compound,complex,or compound/complex?
8. ___________________ is our home planet and it is located ____________ from the Sun.
noah put 40 on his fare card. everytime he rides public transportation, 2.50$ is subtracted from the amount available on his card​
In the passage”Young Goodman Brown” What do Faith's pink ribbons most likely symbolize at this point in the story? O purity O disobedience O understanding O dar
Kory and two of his friends are going to rent a 3 bedroom apartment for $960 a month. The security deposit is $400 and the pet deposit is $260. In addition to t
PLEASE HELP WILL MARK BRAINLIESTTTT!!!! Valence electrons will either ______________ or ______________ to form molecules.
Over the course of 6 days Tonda ran 17.22 miles She ran the same distance each day How far did Tonga run each day ?
1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids:
What were some things that people hated about Russia?​
need help pls public class TestThread extends Thread {private static int x;public synchronized void doSomething () {int current = x;current++;x = current;}publi