kaya1566 kaya1566

23-10-2019
Mathematics

contestada

solve the equation. 1/5 + w = 7 1/3
A. w= 6 2/15
B. w= 7 8/15
C. w= 7 2/15
D. w= 7 1/4
PLEASE HELP.

Respuesta :

jatyhafredrick825 jatyhafredrick825

23-10-2019

C = 7 2/15

107/15 == 7 2/15 decimal 7.13

Answer Link

Otras preguntas

suppose you were to grind the up and homogenate a pancreas. Do you think it would be possible to isolate insulin from this homogenate?

what is 0+50×1-60×0+10=

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

which of the following does NOT describe the process of summation? a. Two ESPSs are generated at the same time by two separate synapses, bringing the cell to th

What is the vapor pressure of water at 750C?

of the 600 workers at a factory, 8.5% belong to a union. how many workers are in the Union?

A 15.6 grams of ethanol absorb 868 J as it is heated. The initial temperature is 21.5 degrees Celsius. What is the final temperature if the specific heat of eth

A red dwarf is _____ A. the remains of a supernova. B. a hot pulsar. C

which of the following does NOT describe the process of summation? a. Two ESPSs are generated at the same time by two separate synapses, bringing the cell to th

how to get the answer to this equation 1+4=5 2+5=12 3+6=21 8+11=?