johnsonchar503 johnsonchar503

24-09-2019
Biology

contestada

What role does a dna play in existence of cell?

Respuesta :

whitingcaden whitingcaden

24-09-2019

Answer:

It's the instruction manual for the cell, you know tells it what to do and stuff.

Explanation:

Answer Link

Otras preguntas

Can anyone to correct it if necessary? Thank you.

Which best explains how the structure of the office of the president helps fulfill the office’s role? A The office is led by the chief of staff, who serves as a

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

write a formula that relates the are A of a triangle to to the lengths of its base b and height h

PLEASE HELP ME AASSAPP

The majority of people that Muhammad came into contact with were A:Monotheistic B:Polytheistic C:A mixture of both

Mrs. Bell's class is selling Hobbs Middle Jaguar t-shirts to raise money for a trip. They typically sell 400 t-shirts a year for $10 per shirt. Mrs bell knows t

what are the best study tips for Sol or finals

1+4 = 5. 2+5=12. 3+6=21 8+11==?

How many times dose 63 go into 359