nuke12345678 nuke12345678

23-09-2019
Mathematics

contestada

To visit his grandmother, Luis takes a train 6.37 kilometers and a car 5.45 kilometers.

How many kilometers is luis’s journey in total?

Respuesta :

brookwyd brookwyd

25-09-2019

Answer:

11.82 kilometers

6.37 + 5.45 = 11.82

Have a good day!

Answer Link

QueenNureeyah QueenNureeyah

04-12-2020

Answer:11.82

Step-by-step explanation:Add the numbers together

Answer Link

Otras preguntas

elevated blood cell count can be a result of: A. bacterial infection B. viral infection C. parasitic infection D. immune hypersensitivity/ allergic reactions E.

Cardiac muscle contracts A. in response to voluntary output B in response to nonvoluntary input C. on its own without input

182,886 rounded to the nearest tenth

Which university was the first to grant a woman a Ph.D. in America?

why are cancer causing factors in lifestyle and environment difficult to identify

Instructions:Select the correct answer .In this line from Thomas Paine's Rights of Man, what element denotes that it is from the Revolutionary era? There exist

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Consider the following piecewise-defined function. f(x){x^2 -5, x<3

How many times dose 63 go into 359

write the complete thermochemical equation (including energy) for the combustion of hexane.