64h 64h
  • 25-10-2018
  • Mathematics
contestada

Please help i will mark brainly.!!

Please help i will mark brainly class=

Respuesta :

Eturieq
Eturieq Eturieq
  • 25-10-2018

Hi, The answer

Is c

Have a good day

Answer Link
kyintellect kyintellect
  • 25-10-2018

5.21 × 10 3rd power would be in scientific notation

Answer Link

Otras preguntas

if f(x) = x^2 -5x +1 and g(x) =5x+4 what is the value of g•f (-2)
True or False: When looking at kinetic vs. thermodynamic products the kinetic product predominates at low temperature.
What does it mean to cross-reference information
A solution containing 0.60 moles of sodium hydroxide is added to excess magnesium sulfate in solution. A white solid, magnesium hydroxide, is formed.a) Write a
Which of the following best describes the sources that contribute to your online identity.
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
Please answer this question fast
what do yall think? answer asap please​
This is an image of the ...........................Topology.if answer Correct i will mark the first person brainly.​
If the average volume flow of blood through the aorta is 8.5 × 10-5 m 3/s and the cross-sectional area of the aorta is 3.0 × 10 -4 m2, what i