chanindu73 chanindu73
  • 21-10-2018
  • History
contestada

What was justinian 1’s full name

Respuesta :

xlajbd
xlajbd xlajbd
  • 21-10-2018
Flavius Justinianus, original name Petrus Sabbatius
Answer Link

Otras preguntas

Throughout the essay, Alexander presents and then responds to the views of others. Find two examples where Alexander introduces the views of others. In each cas
Part A What is the main idea of the essay? Support your answer with evidence from the text.Part BWho is the audience for the article? Include details such as ag
The ratio of the number of pears to the number of apples in the basket was 3 : 5 After Sean ate 2 apples, there were still 2 more apples than pears. How many pe
solve -7(4-x) + 4 is greater than or equal to -18 + 7x
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
Imagine that head shape is controlled by a maternal effect gene. The dominant h allele produces a oval-shaped head, while the recessive h allele produces a squ
The cat is crawling silently ......... the bed 1.with 2.of 3.at 4.towards​
Match the cultural belief to the correct religion Buddhism, Judaism, Islam,Christian Science,Confucianism
Please help !!!!!!!!1) Write the equation for the reaction between the hydrocarbon and bromine using fully displayed formulae for the hydrocarbon and the organi
What are the steps to convert a number from standard notation to scientific notation​