lasvigCatijen
lasvigCatijen lasvigCatijen
  • 26-03-2016
  • History
contestada

To a slave, what was life under slavery?

Respuesta :

FAMOUSGUY
FAMOUSGUY FAMOUSGUY
  • 26-03-2016
Your day consisted of working in the sun all day and only getting fed a little portion of food a day
Answer Link

Otras preguntas

What does the term human rights mean
how would living in Sparta or Athens be like
A jewel case that holds 2 CDs is 140 mm x 120 mm x 9 mm. hat is the surface area of this jewel case?
If two solutions differ in their [H3O+] by a factor of 2.0, the difference in their pH will be 2.0.
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
9. There are many more organisms that use double stranded DNA to carry their genetic information than there are organisms that use single stranded DNA to carry
. Slope intercept for y minus 3x equals 19
How are glial cells and neurons alike and how are they different. Give 3 sentences for each
Does old age means end of life according to A Tennyson in Ulysses
what is similarities and differences freedmen and serfs?