stephanier9187 stephanier9187

26-04-2024
History

contestada

The leaders of which two of the following nations wanted to
punish Germany?
Russia
the United States
France
England
more...

Respuesta :

Otras preguntas

Which of the following statements correctly uses the distributive property? -2(15 - 3) = -2(15) + (-2)(3) 7(9 - 8) = 7(9) - 8 9(-7 + 6) = 9(-7) + 9(6) -3(12 + 5

please help with this

The three greater than signs (>>>) are called the python.

A geologist examining a road cut at this location would recognize that Layer A is than Layer B. This conclusion is made through the principle of

Ali had 5/7 of a spool of yarn. He used 5/6 of his yarn for a project. What fraction of the spool was used for the project? Write your answer in simplest form.

“Applications of thermal expansion in solids, liquids and gases.” (Two for each states of matter)

find three consecutive numbers if their sum is 3n

Identify the class of lever whch is not used for lifting heavy loads but as used for making work faster. Explain your answer.

Total score: of 15 points (Score for Question 1: of 5 points) 1. Graph the function f(x) = sin(x)-2. Answer:

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):