valerie2027posada valerie2027posada

24-04-2024
Biology

contestada

Codons
Which amino acids does this mRNA strand code for?
You must spell out the entire name of the amino acid

5'CCGGAUGUCCGUAUAACGGC3'

Respuesta :

Otras preguntas

PT=x+2, TR=y, QT=2x, TS=y+3

Cindy went to the fruit stand to purchase oranges and bananas. She can purchase 5 oranges and 6 bananas for $2.05 or she can purchase 7 oranges and 8 bananas fo

Your company has received an invoice amounting to $1,500 and the terms are 2/10, net 30. If you decide to pay within 10 days, how much will you have to pay?

According to this equation, F=ma, how much force is needed to accelerate an 82-kg runner at 7.5m/s2? A. 615 N B. 10.9 N C. 615 m/s D. 10.9 m/s

what are the coordinates Y = 6x +11 2y-4x=14

give m an example of age problem

Jackson was making a poster for his room. He arranged 50 trading cards in the shape of a rectangle on the poster. How many rows of cards were on his poster? a)

where was nathaniel alexander the inventor born

1 1/4+2 1/2 what is the awnswer?

What fraction is equal to 9//11