ck424242 ck424242

26-02-2024
Biology

contestada

fill in with the mRNA strand, then translate to the amino acid sequence using this chart. Remember to always start with the start condon, and end with the stop condon. (Condon = 3 rucleotides) DNA: ATGTTTGCATACCAAGGCTAAATTTTC TRANSCRIPTION: mRNA: pROTEIN (AMINO ACID SEQUENCE): Translation

Respuesta :

Otras preguntas

Find a • b if a = 3i + 8j and b= -0.5i - 4j. A. (-1.5, -32) B. -33.5 C. (2.5, 4) D. -30.5

What was the U.S's role in WW1, also, please describe it, Thanks!

What is the percentage of Chilean living in rural areas

Can someone help please?

A triangular pyramid has B = 36 sqauare inches and h = 22 nches. what is the volume of the pyramid?

How can globalization negatively affect the environment in the United States?

Use the drop-down menus to decide if each sentence appeals to logos, pathos, or ethos.

what occurrence allows the narrator to understand more about why Ethan is the way he is

Which of the following is NOT a solution to the inequality graphed below?

A gardener is drawing plans for a new yard. She creates the picture below to represent the size and shape of a new lawn. How can the gardener find the total are