vhhfg8915 vhhfg8915
  • 25-02-2024
  • Social Studies
contestada

Consulting with others or viewing an organization's code of conduct is one way to determine which level of the ethical pyramid?

a. means
b. ends
c. intent
d. motivation
e. purpose

Respuesta :

Otras preguntas

If 1+4=5 and 2+5=12 what does 8+11=
A parking lot in the shape of a trapezoid has an area of 12,052.1 square meters. The length of one base is 82.4 meters, and the length of the other base is 108.
A jewel case that holds 2 CDs is 140 mm x 120 mm x 9 mm. hat is the surface area of this jewel case?
In a monohybrid cross, F2 refers to __________. A)the original mating pair B)the grandparents of the 1st generation C)the 1st filial generation D)the second fil
Can you pleas help me solve this assignment?
What is double consciousness
How are glial cells and neurons alike and how are they different. Give 3 sentences for each
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
What educational level, age and econimic status of the audience do I reach when talking bout geriatric offices
Describe the fluid theory of intelligence; then explain your views on the theory